Different types of antibodies are produced by your immune system. These five antibodies help fight disease by detecting viruses, bacteria, and other pathogens (disease-causing microorganisms) and ...

Sjögren’s antibody testing is done using a blood sample. It checks antibody levels, including anti-SS-A (also called anti-Ro) and anti-SS-B (also called anti-La). Anti-SS-A and anti-SS-B are ...

Ideally, the immune system will produce long-lasting antibodies recognizing that specific virus, thereby providing protection. But Scripps Research scientists have now discovered that for some HIV ...

Mitochondrial metabolism requires the chaperoned import of disulfide-stabilized proteins via CHCHD4/MIA40 and its enigmatic interaction with oxidoreductase Apoptosis-inducing factor (AIF). By ...

The primers for DE-DRGs were as follows: Leucine-rich pentatricopeptide repeat-containing (LRPPRC) forward primer: AATGGCGCAGCTTTAAGAGG, reverse primer: ATGTTGGTGGATGGTTCTGC; NADH dehydrogenase ...

Immunotherapy against cancer: How therapeutic antibodies do their job Date: January 10, 2025 Source: University of Würzburg Summary: A look at cancer cells: Thanks to an innovative method of ...

MIT’s new AI model predicts antibody structures with greater accuracy, aiding disease treatment and streamlining drug discovery. With this model, researchers may be able to discover antibody drugs ...

NADH, also known as nicotinamide adenine dinucleotide, is a crucial coenzyme present in every cell of our bodies, serving as an elemental source for energy production. It aids in turning the food ...

One way the immune system protects the body from germs and other foreign substances is by making large numbers of antibodies. An antibody is a protein that sticks to a specific protein called an ...